A genética está entre as áreas mais estudadas em saúde humana. E hoje, mais do que nunca, as aplicações práticas das descobertas científicas dessa área vêm sendo muito disseminadas.

De forma bastante breve, pode-se dizer que a genética se concentra no estudo dos genes e de como eles atuam no nosso corpo, como eles regulam a nossa fisiologia. 

Para informar e atualizar você, nutricionista, sobre os termos e conceitos básicos de genética, é que produzimos este artigo. Boa leitura!

O que é o DNA? E o que é o gene?

O DNA nada mais é que a molécula onde estão guardadas todas as informações para fazer o nosso organismo funcionar adequadamente.

O DNA fica no núcleo das células e é formado por pequenas peças, os nucleotídeos, sendo que cada um deles carrega uma das quatro unidades químicas: Adenina, Timina, Citosina e Guanina, que nós conhecemos pelas suas iniciais, A, T, C e G, respectivamente. 

Assim, o DNA é formado por uma sequência desses nucleotídeos que se repetem bilhões e bilhões de vezes, compondo instruções em forma de código, chamado de código genético.

É a partir da “leitura” desse código que cada célula é capaz de produzir inúmeros tipos de proteínas que fazem parte do aparato fisiológico dela, por exemplo: receptores e transportadores celulares, proteínas reguladoras, anticorpos, hormônios, e uma série de outros componentes necessários para o funcionamento celular.

E o gene é a denominação de cada parte do DNA onde estão as informações para produzir cada uma dessas proteínas.

E graças às tecnologias que temos hoje no laboratório, nós conseguimos saber qual o código genético de cada pessoa

Como o DNA e os genes impactam a nossa fisiologia?

O conjunto de informações que vem de cada um dos nossos genes é que vai indicar a maioria das nossas características. Por exemplo, qual será a cor dos nossos olhos, qual a textura da pele, a resistência dos ossos, como absorvemos e digerimos os nutrientes, e assim por diante.

Acontece que o DNA de cada pessoa traz pequenas variações de informações, e é exatamente isso o que nos faz diferentes uns dos outros, o que inclui as diferenças do nosso metabolismo.

Por isso algumas pessoas têm, por exemplo, maior facilidade para emagrecer, outras pessoas têm mais facilidade para ganhar massa muscular. Tem pessoas que conseguem metabolizar melhor a vitamina B e o ômega-3 e necessitam de menores doses desses nutrientes, enquanto outras precisam de doses maiores para ter o mesmo efeito no organismo, etc…

Em geral, essas variações genéticas entre as pessoas nos indicam como cada uma delas tende a responder ao ambiente externo e isso inclui a alimentação. Como existem variações ou diferentes formas do mesmo gene, quando ela está presente em mais de 1% da população, chamamos isso de Polimorfismo, que quer dizer “várias formas”.

Essas diferentes formas ou variações nos genes são bastante comuns entre as pessoas e isso se deve a diferenças na sequência de nucleotídeos que um gene pode apresentar.

Por exemplo, se a gente considera um mesmo gene, algumas pessoas podem ter numa determinada posição da sequência de informação desse gene uma Adenina (A), enquanto outras pessoas podem ter nessa mesma posição uma Citosina (C). E isso altera totalmente a informação que está ali, podendo gerar resultados diferentes no metabolismo.

E o que significam os termos Alelo, Genótipo e Genótipo de Risco?

A mudança de apenas um nucleotídeo vai produzir uma diferença de informação que o gene carrega, criando uma versão diferente do mesmo gene. E cada versão diferente de um gene é chamada de alelo.

Isso pode impactar, por exemplo, em como as pessoas podem responder à alimentação. Daí que diferentes pessoas reagem de forma distinta ao mesmo tipo de alimento.

Geralmente no nosso DNA nós carregamos duas cópias de cada gene, que é mesma coisa que dizer que nós carregamos duas versões ou dois alelos de cada um dos nossos genes – sendo que um alelo vem da mãe e o outro alelo vem do pai. 

Se usarmos como exemplo o gene responsável pela produção da enzima que metaboliza a cafeína, um dos alelos desse gene tem uma sequência que gera a informação para a produção da enzima que metaboliza a cafeína de uma forma rápida.

Esse mesmo gene tem um outro alelo, uma outra versão diferente da sequência de nucleotídeos, que carrega a informação para fazer a enzima que metaboliza a cafeína mais lentamente, com no exemplo abaixo

Gene CYP1A2 (metabolização da cafeína)

ALELO A: …ATCTCTTAGTAGAGTTCGCGTTA… – enzima de metabolização rápida 

ALELO C: …ATCTCTTAGTCGAGTTCGCGTTA… – enzima de metabolização lenta

Assim para cada gene podemos ter alelos iguais, tendo os dois alelos a mesma sequência de nucleotídeos ou alelos diferentes, cada um deles tendo uma sequência diferente de nucleotídeos.

Levando em conta que cada pessoa tem a combinação de dois alelos, as possibilidades para o gene que metaboliza a cafeína, por exemplo, são que ou uma pessoa tem dois alelos com a A naquela posição, ou dois alelos com a C, ou então um alelo com a A e o outro alelo com C. Segue o exemplo abaixo:

  • ALELO (A) + ALELO (A) = GENÓTIPO A/A
  • ALELO (A) + ALELO (C) = GENÓTIPO A/C
  • ALELO (C) + ALELO (C) = GENÓTIPO C/C

E essa combinação dos dois alelos e cada gene é chamada de genótipo.

Quando o genótipo tem um desfecho metabólico indesejável ou desfavorável, que pode ser ruim para o organismo, como a metabolização mais lenta da cafeína, chamamos isso de genótipo de risco.

Mas são apenas os genes que contam?

Para finalizar, além do DNA que é único para cada pessoa, cada um também vive de um jeito, se alimenta do seu jeito.

Cada um tem seu tempo ideal de sono, alguns gostam de fazer exercícios físicos, outros não; alguns têm maior autocontrole e outros não; alguns vivem no campo e inalam ar puro, enquanto outros moram em centros urbanos com o ar mais poluído; há pessoas que possuem uma alimentação saudável e tem os que só consomem fast-food…

As diferenças das pessoas são inúmeras, mas o que conta no final de tudo não é apenas o efeito conjunto de todos os genes que carregamos. Muito também se deve ao nosso comportamento, ao jeito como vivemos. Então é o conjunto do efeito dos genes mais o estilo de vida que a gente leva que dá o resultado final.

Logo, conhecer a genética é importante para saber sobre as nossas potencialidades, mas ter cuidado para manter a saúde é fundamental para ter qualidade de vida!